WUR Journal browser

WUR Journal browser

  • external user (warningwarning)
  • Log in as
  • The Journal Browser provides a list of more than 30,000 journals. It can be consulted by authors who wish to select a journal for publishing their manuscript Open Access. The information in this list is aggregated from several sources on a regular basis:

    • A list of journals for which the Association of Universities in the Netherlands (VSNU) has made deals with publishers, to make articles Open Access. Under these deals, corresponding authors of Dutch universities can publish their articles Open Access in the participating journals with discounts on the article processing charges (APCs).
    • A list of journals covered by the Journal Citation Reports.
    • A list of journals covered by Scopus.
    • Journals indexed in the Directory of Open Access Journals (DOAJ).
    • Lists of journals for which specific Dutch universities have made deals with publishers, to make articles Open Access. Under these deals, corresponding authors of these universities can publish their articles Open Access in the participating journals with discounts on the article processing charges (APCs). Depending on the university from which the Journal Browser is consulted, this information is shown.
    • Additional data on citations made to journals, in articles published by staff from a specific Dutch university, that are made available by that university. Depending on the university from which the Journal Browser is consulted, this information is shown.

    In the Journal Browser, a search box can be used to look up journals on certain subjects. The terms entered in this box are used to search the journal titles and other metadata (e.g. keywords).

    After having selected journals by subject, it is possible to apply additional filters. These concern no/full costs and discounts for Open Access publishing, support on Open Access publishing in journals, and the quartile to which the journal’s impact factor belongs.

    When one selects a journal in the Journal Browser, the following information may be presented:

    • General information about the selected journal such as title and ISSNs, together with a link to the journal’s website.
    • APC discount that holds for the selected journal if it is part of an Open Access deal.
    • Impact measures for the selected journal from Journal Citation Reports or Scopus. The impact measures that are shown may vary, depending on the university from which the Journal Browser is consulted. For some universities, the number of citations made to the selected journal (in articles published by staff from that university) is also shown.
    • Information from Sherpa/Romeo on the conditions under which articles from the selected journal may be made available via Green Open Access.
    • A listing of articles recently published in the selected journal.
    • For some universities, information is available on what journals have been co-cited most frequently together with the selected journal (in articles published by staff from these universities). When available, this information is presented under ‘similar journals’.
    About

Nucleic Acids Research

Oxford University Press

1974-

ISSN: 0305-1048 (1362-4954, 1362-4962)
Biochemistry & Molecular Biology - Genetics - DNA - biochemistry - computational biology - genomics - molecular biology - RNA
open_access_logo.gif
Full APC costs (no discount)

Recent articles

1 show abstract
0305-1048 * 1362-4962 * 29678539

DNA replication is a stochastic process with replication forks emanating from multiple replication origins. The origins must be licenced in G1, and the replisome activated at licenced origins in order to generate bi-directional replication forks in S-phase. Differential firing times lead to origin interference, where a replication fork from an origin can replicate through and inactivate neighbouring origins (origin obscuring). We developed a Bayesian algorithm to characterize origin firing statistics from Okazaki fragment (OF) sequencing data. Our algorithm infers the distributions of firing times and the licencing probabilities for three consecutive origins. We demonstrate that our algorithm can distinguish partial origin licencing and origin obscuring in OF sequencing data from Saccharomyces cerevisiae and human cell types. We used our method to analyse the decreased origin efficiency under loss of Rat1 activity in S. cerevisiae, demonstrating that both reduced licencing and increased obscuring contribute. Moreover, we show that robust analysis is possible using only local data (across three neighbouring origins), and analysis of the whole chromosome is not required. Our algorithm utilizes an approximate likelihood and a reversible jump sampling technique, a methodology that can be extended to analysis of other mechanistic processes measurable through Next Generation Sequencing data.
2 show abstract
0305-1048 * 1362-4962 * 29678540

TDP-43 regulates cellular levels of Cajal bodies (CBs) that provide platforms for the assembly and RNA modifications of small nuclear ribonucleoproteins (snRNPs) involved in pre-mRNA splicing. Alterations in these snRNPs may be linked to pathogenesis of amyotrophic lateral sclerosis. However, specific roles for TDP-43 in CBs remain unknown. Here, we demonstrate that TDP-43 regulates the CB localization of four UG-rich motif-bearing C/D-box-containing small Cajal body-specific RNAs (C/D scaRNAs; i.e. scaRNA2, 7, 9 and 28) through the direct binding to these scaRNAs. TDP-43 enhances binding of a CB-localizing protein, WD40-repeat protein 79 (WDR79), to a subpopulation of scaRNA2 and scaRNA28; the remaining population of the four C/D scaRNAs was localized to CB-like structures even with WDR79 depletion. Depletion of TDP-43, in contrast, shifted the localization of these C/D scaRNAs, mainly into the nucleolus, as well as destabilizing scaRNA2, and reduced the site-specific 2′-O-methylation of U1 and U2 snRNAs, including at 70A in U1 snRNA and, 19G, 25G, 47U and 61C in U2 snRNA. Collectively, we suggest that TDP-43 and WDR79 have separate roles in determining CB localization of subsets of C/D and H/ACA scaRNAs.
3 show abstract
0305-1048 * 1362-4962 * 29678541

Nucleic acid mimics of fluorescent proteins can be valuable tools to locate and image functional biomolecules in cells. Stacking between the internal G-quartet, formed in the mimics, and the exogenous fluorophore probes constitutes the basis for fluorescence emission. The precision of recognition depends upon probes selectively targeting the specific G-quadruplex in the mimics. However, the design of probes recognizing a G-quadruplex with high selectivity in vitro and in vivo remains a challenge. Through structure-based screening and optimization, we identified a light-up fluorescent probe, 9CI that selectively recognizes c-MYC Pu22 G-quadruplex both in vitro and ex vivo. Upon binding, the biocompatible probe emits both blue and green fluorescence with the excitation at 405 nm. With 9CI and c-MYC Pu22 G-quadruplex complex as the fluorescent response core, a DNA mimic of fluorescent proteins was constructed, which succeeded in locating a functional aptamer on the cellular periphery. The recognition mechanism analysis suggested the high selectivity and strong fluorescence response was attributed to the entire recognition process consisting of the kinetic match, dynamic interaction, and the final stacking. This study implies both the single stacking state and the dynamic recognition process are crucial for designing fluorescent probes or ligands with high selectivity for a specific G-quadruplex structure.
4 show abstract
0305-1048 * 1362-4962 * 29678542

The RNA-binding protein GRSF1 (G-rich RNA sequence-binding factor 1) critically maintains mitochondrial homeostasis. Accordingly, loss of GRSF1 impaired mitochondrial respiration and increased the levels of reactive oxygen species (ROS), triggering DNA damage, growth suppression, and a senescent phenotype characterized by elevated production and secretion of interleukin (IL)6. Here, we characterize the pathways that govern IL6 production in response to mitochondrial dysfunction in GRSF1-depleted cells. We report that loss of GRSF1 broadly altered protein expression programs, impairing the function of respiratory complexes I and IV. The rise in oxidative stress led to increased DNA damage and activation of mTOR, which in turn activated NF-κB to induce IL6 gene transcription and orchestrate a pro-inflammatory program. Collectively, our results indicate that GRSF1 helps preserve mitochondrial homeostasis, in turn preventing oxidative DNA damage and the activation of mTOR and NF-κB, and suppressing a transcriptional pro-inflammatory program leading to increased IL6 production.
5 show abstract
0305-1048 * 1362-4962 * 29678543

Most eukaryotic expression systems make use of host-cell nuclear transcriptional and post-transcriptional machineries. Here, we present the first generation of the chimeric cytoplasmic capping-prone phage polymerase (C3P3-G1) expression system developed by biological engineering, which generates capped and polyadenylated transcripts in host-cell cytoplasm by means of two components. First, an artificial single-unit chimeric enzyme made by fusing an mRNA capping enzyme and a DNA-dependent RNA polymerase. Second, specific DNA templates designed to operate with the C3P3-G1 enzyme, which encode for the transcripts and their artificial polyadenylation. This system, which can potentially be adapted to any in cellulo or in vivo eukaryotic expression applications, was optimized for transient expression in mammalian cells. C3P3-G1 shows promising results for protein production in Chinese Hamster Ovary (CHO-K1) cells. This work also provides avenues for enhancing the performances for next generation C3P3 systems.
6 show abstract
0305-1048 * 1362-4962 * 29678544

Nucleic Acids Research, 2015, 43(19): 9362–9378, https://doi.org/10.1093/nar/gkv988
7 show abstract
0305-1048 * 1362-4962 * 29678545

The formation of intercalated motifs (iMs) — secondary DNA structures based on hemiprotonated C.C+ pairs in suitable cytosine-rich DNA sequences, is reflected by typical changes in CD and UV absorption spectra. By means of spectroscopic methods, electrophoresis, chemical modifications and other procedures, we characterized iM formation and stability in sequences with different cytosine block lengths interrupted by various numbers and types of nucleotides. Particular attention was paid to the formation of iMs at pH conditions close to neutral. We identified the optimal conditions and minimal requirements for iM formation in DNA sequences, and addressed gaps and inaccurate data interpretations in existing studies to specify principles of iM formation and modes of their folding.
8 show abstract
0305-1048 * 1362-4962 * 29678546

Nucleic Acids Research, 2019, Vol. 47, Database issue, Pages D128–D134, https://doi.org/10.1093/nar/gky960
9 show abstract
0305-1048 * 1362-4962 * 29678547

Nucleic Acids Research, 2017, 45: 12932–12944, https://doi.org/10.1093/nar/gkx1073
10 show abstract
0305-1048 * 1362-4962 * 29678548

The codon stabilization coefficient (CSC) is derived from the correlation between each codon frequency in transcripts and mRNA half-life experimental data. In this work, we used this metric as a reference to compare previously published Saccharomyces cerevisiae mRNA half-life datasets and investigate how codon composition related to protein levels. We generated CSCs derived from nine studies. Four datasets produced similar CSCs, which also correlated with other independent parameters that reflected codon optimality, such as the tRNA abundance and ribosome residence time. By calculating the average CSC for each gene, we found that most mRNAs tended to have more non-optimal codons. Conversely, a high proportion of optimal codons was found for genes coding highly abundant proteins, including proteins that were only transiently overexpressed in response to stress conditions. We also used CSCs to identify and locate mRNA regions enriched in non-optimal codons. We found that these stretches were usually located close to the initiation codon and were sufficient to slow ribosome movement. However, in contrast to observations from reporter systems, we found no position-dependent effect on the mRNA half-life. These analyses underscore the value of CSCs in studies of mRNA stability and codon bias and their relationships with protein expression.
11 show abstract
0305-1048 * 1362-4962 * 29678549

tRNA are post-transcriptionally modified by chemical modifications that affect all aspects of tRNA biology. An increasing number of mutations underlying human genetic diseases map to genes encoding for tRNA modification enzymes. However, our knowledge on human tRNA-modification genes remains fragmentary and the most comprehensive RNA modification database currently contains information on approximately 20% of human cytosolic tRNAs, primarily based on biochemical studies. Recent high-throughput methods such as DM-tRNA-seq now allow annotation of a majority of tRNAs for six specific base modifications. Furthermore, we identified large gaps in knowledge when we predicted all cytosolic and mitochondrial human tRNA modification genes. Only 48% of the candidate cytosolic tRNA modification enzymes have been experimentally validated in mammals (either directly or in a heterologous system). Approximately 23% of the modification genes (cytosolic and mitochondrial combined) remain unknown. We discuss these ‘unidentified enzymes’ cases in detail and propose candidates whenever possible. Finally, tissue-specific expression analysis shows that modification genes are highly expressed in proliferative tissues like testis and transformed cells, but scarcely in differentiated tissues, with the exception of the cerebellum. Our work provides a comprehensive up to date compilation of human tRNA modifications and their enzymes that can be used as a resource for further studies.
12 show abstract
0305-1048 * 1362-4962 * 29678550

Six 1′,5′-anhydrohexitol uridine triphosphates were synthesized with aromatic substitutions appended via a carboxamide linker to the 5-position of their bases. An improved method for obtaining such 5-substituted hexitol nucleosides and nucleotides is described. The incorporation profile of the nucleotide analogues into a DNA duplex overhang using recently evolved XNA polymerases is compared. Long, mixed HNA sequences featuring the base modifications are generated. The apparent binding affinity of four of the nucleotides to the enzyme, the rate of the chemical step and of product release, plus the specificity constant for the incorporation of these modified nucleotides into a DNA duplex overhang using the HNA polymerase T6G12_I521L are determined via pre-steady-state kinetics. HNA polymers displaying aromatic functional groups could have significant impact on the isolation of stable and high-affinity binders and catalysts, or on the design of nanomaterials.
13 show abstract
0305-1048 * 1362-4962 * 29678551

Experimental studies of Escherichia coli K-12 MG1655 often implicate poorly annotated genes in cellular phenotypes. However, we lack a systematic understanding of these genes. How many are there' What information is available for them' And what features do they share that could explain the gap in our understanding' Efforts to build predictive, whole-cell models of E. coli inevitably face this knowledge gap. We approached these questions systematically by assembling annotations from the knowledge bases EcoCyc, EcoGene, UniProt and RegulonDB. We identified the genes that lack experimental evidence of function (the ‘y-ome’) which include 1600 of 4623 unique genes (34.6%), of which 111 have absolutely no evidence of function. An additional 220 genes (4.7%) are pseudogenes or phantom genes. y-ome genes tend to have lower expression levels and are enriched in the termination region of the E. coli chromosome. Where evidence is available for y-ome genes, it most often points to them being membrane proteins and transporters. We resolve the misconception that a gene in E. coli whose primary name starts with ‘y’ is unannotated, and we discuss the value of the y-ome for systematic improvement of E. coli knowledge bases and its extension to other organisms.
14 show abstract
0305-1048 * 1362-4962 * 29678552

RNA-binding proteins (RBPs) play pivotal roles in directing RNA fate and function. Yet the current annotation of RBPs is largely limited to proteins carrying known RNA-binding domains. To systematically reveal dynamic RNA–protein interactions, we surveyed the human proteome by a protein array-based approach and identified 671 proteins with RNA-binding activity. Among these proteins, 525 lack annotated RNA-binding domains and are enriched in transcriptional and epigenetic regulators, metabolic enzymes, and small GTPases. Using an improved CLIP (crosslinking and immunoprecipitation) method, we performed genome-wide target profiling of isocitrate dehydrogenase 1 (IDH1), a novel RBP. IDH1 binds to thousands of RNA transcripts with enriched functions in transcription and chromatin regulation, cell cycle and RNA processing. Purified IDH1, but not an oncogenic mutant, binds directly to GA- or AU-rich RNA that are also enriched in IDH1 CLIP targets. Our study provides useful resources of unconventional RBPs and IDH1-bound transcriptome, and convincingly illustrates, for the first time, the in vivo and in vitro RNA targets and binding preferences of IDH1, revealing an unanticipated complexity of RNA regulation in diverse cellular processes.
15 show abstract
0305-1048 * 1362-4962 * 29678553

Short tandem repeats (STRs) are polymorphic genomic loci valuable for various applications such as research, diagnostics and forensics. However, their polymorphic nature also introduces noise during in vitro amplification, making them difficult to analyze. Although it is possible to overcome stutter noise by using amplification-free library preparation, such protocols are presently incompatible with single cell analysis and with targeted-enrichment protocols. To address this challenge, we have designed a method for direct measurement of in vitro noise. Using a synthetic STR sequencing library, we have calibrated a Markov model for the prediction of stutter patterns at any amplification cycle. By employing this model, we have managed to genotype accurately cases of severe amplification bias, and biallelic STR signals, and validated our model for several high-fidelity PCR enzymes. Finally, we compared this model in the context of a naïve STR genotyping strategy against the state-of-the-art on a benchmark of single cells, demonstrating superior accuracy.
16 show abstract
0305-1048 * 1362-4962 * 29678554

Hepatitis C virus (HCV) infection is the leading cause of chronic hepatitis, which often results in liver fibrosis, cirrhosis and hepatocellular carcinoma (HCC). HCV possesses an RNA genome and its replication is confined to the cytoplasm. Yet, infection with HCV leads to global changes in gene expression, and chromosomal instability (CIN) in the host cell. The mechanisms by which the cytoplasmic virus affects these nuclear processes are elusive. Here, we show that HCV modulates the function of the Structural Maintenance of Chromosome (SMC) protein complex, cohesin, which tethers remote regions of chromatin. We demonstrate that infection of hepatoma cells with HCV leads to up regulation of the expression of the RAD21 cohesin subunit and changes cohesin residency on the chromatin. These changes regulate the expression of genes associated with virus-induced pathways. Furthermore, siRNA downregulation of viral-induced RAD21 reduces HCV infection. During mitosis, HCV infection induces hypercondensation of chromosomes and the appearance of multi-centrosomes. We provide evidence that the underlying mechanism involves the viral NS3/4 protease and the cohesin regulator, WAPL. Altogether, our results provide the first evidence that HCV induces changes in gene expression and chromosome structure of infected cells by modulating cohesin.
17 show abstract
0305-1048 * 1362-4962 * 29678555

Self-priming amplification of oligonucleotides is possible based on foldback of 3′ ends, self-priming, and concatemerization, especially in the presence of phosphorothioate linkages. Such a simple replicative mechanism may have led to the accumulation of specific replicators at or near the origin of life. To determine how early replicators may have competed with one another, we have carried out selections with phosphorothiolated hairpins appended to a short random sequence library (N10). Upon the addition of deoxynucleoside triphosphates and a polymerase, concatemers quickly formed, and those random sequences that templated the insertion of purines, especially during initiation, quickly predominated. Over several serial transfers, particular sequences accumulated, and in isolation these were shown to outcompete less efficient replicators.
18 show abstract
0305-1048 * 1362-4962 * 29678556

Helicases are biomolecular motors that unwind nucleic acids, and their regulation is essential for proper maintenance of genomic integrity. Escherichia coli Rep helicase, whose primary role is to help restart stalled replication, serves as a model for Superfamily I helicases. The activity of Rep-like helicases is regulated by two factors: their oligomeric state, and the conformation of the flexible subdomain 2B. However, the mechanism of control is not well understood. To understand the factors that regulate the active state of Rep, here we investigate the behavior of a 2B-deficient variant (RepΔ2B) in relation to wild-type Rep (wtRep). Using a single-molecule optical tweezers assay, we explore the effects of oligomeric state, DNA geometry, and duplex stability on wtRep and RepΔ2B unwinding activity. We find that monomeric RepΔ2B unwinds more processively and at a higher speed than the activated, dimeric form of wtRep. The unwinding processivity of RepΔ2B and wtRep is primarily limited by ‘strand-switching’—during which the helicases alternate between strands of the duplex—which does not require the 2B subdomain, contrary to a previous proposal. We provide a quantitative model of the factors that enhance unwinding processivity. Our work sheds light on the mechanisms of regulation of unwinding by Rep-like helicases.
19 show abstract
0305-1048 * 1362-4962 * 29678557

Metagenomic studies, greatly promoted by the fast development of next-generation sequencing (NGS) technologies, uncover complex structures of microbial communities and their interactions with environment. As the majority of microbes lack information of genome sequences, it is essential to assemble prokaryotic genomes ab initio aiming to retrieve complete coding genes from various metabolic pathways. The complex nature of microbial composition and the burden of handling a vast amount of metagenomic data, bring great challenges to the development of effective and efficient bioinformatic tools. Here we present a protein assembler (MetaPA), based on de Bruijn graph searching on oligopeptide spaces and can be applied on both metagenomic and metatranscriptomic sequencing data. When public homologous protein sequences are involved to guide the assembling procedures, MetaPA assembles 85% of total proteins in complete sequences with high precision of 83% on real high-throughput sequencing datasets. Application of MetaPA on metatranscriptomic data successfully identifies the majority of actively transcribed genes validated in related studies. The results suggest that MetaPA has a good potential in both metagenomic and metatranscriptomic studies to characterize the composition and abundance of microbiota.
20 show abstract
0305-1048 * 1362-4962 * 29678558

MicroRNAs play important roles in many biological processes. Their aberrant expression can have oncogenic or tumor suppressor function directly participating to carcinogenesis, malignant transformation, invasiveness and metastasis. Indeed, miRNA profiles can distinguish not only between normal and cancerous tissue but they can also successfully classify different subtypes of a particular cancer. Here, we focus on a particular class of transcripts encoding polycistronic miRNA genes that yields multiple miRNA components. We describe ‘clustered MiRNA Master Regulator Analysis (ClustMMRA)’, a fully redesigned release of the MMRA computational pipeline (MiRNA Master Regulator Analysis), developed to search for clustered miRNAs potentially driving cancer molecular subtyping. Genomically clustered miRNAs are frequently co-expressed to target different components of pro-tumorigenic signaling pathways. By applying ClustMMRA to breast cancer patient data, we identified key miRNA clusters driving the phenotype of different tumor subgroups. The pipeline was applied to two independent breast cancer datasets, providing statistically concordant results between the two analyses. We validated in cell lines the miR-199/miR-214 as a novel cluster of miRNAs promoting the triple negative breast cancer (TNBC) phenotype through its control of proliferation and EMT.
21 show abstract
0305-1048 * 1362-4962 * 29678559

Since the discovery of 5-hydroxymethylcytosine (5hmC) as a prominent DNA modification found in mammalian genomes, an emergent question has been what role this mark plays in gene regulation. 5hmC is hypothesized to function as an intermediate in the demethylation of 5-methylcytosine (5mC) and in the reactivation of silenced promoters and enhancers. Further, weak positive correlations are observed between gene body 5hmC and gene expression. We previously demonstrated that ME-Class is an effective tool to understand relationships between whole-genome bisulfite sequencing data and expression. In this work, we present ME-Class2, a machine-learning based tool to perform integrative 5mCG, 5hmCG and expression analysis. Using ME-Class2 we analyze whole-genome single-base resolution 5mCG and 5hmCG datasets from 20 primary tissue and cell samples to reveal relationships between 5hmCG and expression. Our analysis indicates that conversion of 5mCG to 5hmCG within 2 kb of the transcription start site associates with distinct functions depending on the summed level of 5mCG + 5hmCG. Unchanged levels of 5mCG + 5hmCG (conversion from 5mCG to stable 5hmCG) associate with repression. Meanwhile, decreases in 5mCG + 5hmCG (5hmCG-mediated demethylation) associate with gene activation. Our results demonstrate that ME-Class2 will prove invaluable to interpret genome-wide 5mC and 5hmC datasets and guide mechanistic studies into the function of 5hmCG.
22 show abstract
0305-1048 * 1362-4962 * 29678560

Hammerhead ribozyme is the smallest and best characterized catalytic RNA-cleaving ribozyme. It has been reported as potential therapeutic tools to manipulate the expression of target genes. However, most of naturally occurring hammerhead ribozymes process self-cleavage rather than cleave substrate RNA in trans, and its high intracellular activity relies on the tertiary interaction of Loop II and steam I bulge, resulting in decreased performance as applied in gene silencing. We described a direct intracellular selection method to evolve hammerhead variants based on trans-cleavage mode via using a toxin gene as the reporter. And a dual fluorescence proteins system has also been established to quantitatively evaluate the efficiency of selected ribozymes in the cell. Based on this selection strategy, we obtained three mutants with enhanced intracellular cleaving activity compared to wide type hammerhead ribozyme. The best one, TX-2 was revealed to possess better and consistent gene knockdown ability at different positions on diverse targeted mRNA either in prokaryotic or eukaryotic cells than wild-type hammerhead ribozyme. These observations imply the efficiency of the intracellular selection method of the trans-acting ribozyme and the potentials of improved ribozyme variants for research and therapeutic purposes.
23 show abstract
0305-1048 * 1362-4962 * 29678561

The characterization of knots formed in duplex DNA has proved useful to infer biophysical properties and the spatial trajectory of DNA, both in free solution and across its macromolecular interactions. Since knotting, like supercoiling, makes DNA molecules more compact, DNA knot probability and knot complexity can be assessed by the electrophoretic velocity of nicked DNA circles. However, the chirality of the DNA knots has to be determined by visualizing the sign of their DNA crossings by means of electron microscopy. This procedure, which requires purifying the knotted DNA molecules and coating them with protein, is semi-quantitative and it is impracticable in biological samples that contain little amount of knotted DNA forms. Here, we took advantage of an earlier observation that the two chiral forms of a trefoil knot acquire slightly different electrophoretic velocity when the DNA is supercoiled. We introduced a second gel dimension to reveal these chiral forms in DNA mixtures that are largely unknotted. The result is a high-resolution 2D-gel electrophoresis procedure that quantitatively discerns the fractions of positive- and negative-noded trefoil knots formed in vitro and in vivo systems. This development in DNA knot analysis may uncover valuable information toward disclosing the architecture of DNA ensembles.
24 show abstract
0305-1048 * 1362-4962 * 29678562

Motor enzymes that process nucleic-acid substrates play vital roles in all aspects of genome replication, expression, and repair. The DNA and RNA nucleobases are known to affect the kinetics of these systems in biologically meaningful ways. Recently, it was shown that DNA bases control the translocation speed of helicases on single-stranded DNA, however the cause of these effects remains unclear. We use single-molecule picometer-resolution nanopore tweezers (SPRNT) to measure the kinetics of translocation along single-stranded DNA by the helicase Hel308 from Thermococcus gammatolerans. SPRNT can measure enzyme steps with subangstrom resolution on millisecond timescales while simultaneously measuring the absolute position of the enzyme along the DNA substrate. Previous experiments with SPRNT revealed the presence of two distinct substates within the Hel308 ATP hydrolysis cycle, one [ATP]-dependent and the other [ATP]-independent. Here, we analyze in-depth the apparent sequence dependent behavior of the [ATP]-independent step. We find that DNA bases at two sites within Hel308 control sequence-specific kinetics of the [ATP]-independent step. We suggest mechanisms for the observed sequence-specific translocation kinetics. Similar SPRNT measurements and methods can be applied to other nucleic-acid-processing motor enzymes.
25 show abstract
0305-1048 * 1362-4962 * 29678563

Hippo pathway is involved in tumorigenesis, and its regulation in cytosol has been extensively studied, but its regulatory mechanisms in the nuclear are not clear. In the current study, using a FBS-inducing model following serum starvation, we identified KDM3A, a demethylase of histone H3K9me1/2, as a positive regulator for hippo target genes. KDM3A promotes gene expression through two mechanisms, one is to upregulate YAP1 expression, and the other is to facilitate H3K27ac on the enhancers of hippo target genes. H3K27ac upregulation is more relevant with gene activation, but not H3K4me3; and KDM3A depletion caused H3K9me2 upregulation mainly on TEAD1-binding enhancers rather than gene bodies, further resulting in H3K27ac decrease, less TEAD1 binding on enhancers and impaired transcription. Moreover, KDM3A is associated with p300 and required for p300 recruitment to enhancers. KDM3A deficiency delayed cancer cell growth and migration, which was rescued by YAP1 expression. KDM3A expression is correlated with YAP1 and hippo target genes in colorectal cancer patient tissues, and may serve as a potential prognosis mark. Taken together, our study reveals novel mechanisms for hippo signaling and enhancer activation, which is critical for tumorigenesis of colorectal cancer.
26 show abstract
0305-1048 * 1362-4962 * 29678564

Transposable elements (TEs) are interspersed repeat sequences that make up much of the human genome. Their expression has been implicated in development and disease. However, TE-derived RNA-seq reads are difficult to quantify. Past approaches have excluded these reads or aggregated RNA expression to subfamilies shared by similar TE copies, sacrificing quantitative accuracy or the genomic context necessary to understand the basis of TE transcription. As a result, the effects of TEs on gene expression and associated phenotypes are not well understood. Here, we present Software for Quantifying Interspersed Repeat Expression (SQuIRE), the first RNA-seq analysis pipeline that provides a quantitative and locus-specific picture of TE expression (https://github.com/wyang17/SQuIRE). SQuIRE is an accurate and user-friendly tool that can be used for a variety of species. We applied SQuIRE to RNA-seq from normal mouse tissues and a Drosophila model of amyotrophic lateral sclerosis. In both model organisms, we recapitulated previously reported TE subfamily expression levels and revealed locus-specific TE expression. We also identified differences in TE transcription patterns relating to transcript type, gene expression and RNA splicing that would be lost with other approaches using subfamily-level analyses. Altogether, our findings illustrate the importance of studying TE transcription with locus-level resolution.
27 show abstract
0305-1048 * 1362-4962 * 29678565


Helicobacter pylori encodes a large number of restriction–modification (R–M) systems despite its small genome. R–M systems have been described as ‘primitive immune systems’ in bacteria, but the role of methylation in bacterial gene regulation and other processes is increasingly accepted. Every H. pylori strain harbours a unique set of R–M systems resulting in a highly diverse methylome. We identified a highly conserved GCGC-specific m5C MTase (JHP1050) that was predicted to be active in all of 459 H. pylori genome sequences analyzed. Transcriptome analysis of two H. pylori strains and their respective MTase mutants showed that inactivation of the MTase led to changes in the expression of 225 genes in strain J99, and 29 genes in strain BCM-300. Ten genes were differentially expressed in both mutated strains. Combining bioinformatic analysis and site-directed mutagenesis, we demonstrated that motifs overlapping the promoter influence the expression of genes directly, while methylation of other motifs might cause secondary effects. Thus, m5C methylation modifies the transcription of multiple genes, affecting important phenotypic traits that include adherence to host cells, natural competence for DNA uptake, bacterial cell shape, and susceptibility to copper.
28 show abstract
0305-1048 * 1362-4962 * 29678566

In trypanosomes, in contrast to most eukaryotes, the large subunit (LSU) ribosomal RNA is fragmented into two large and four small ribosomal RNAs (srRNAs) pieces, and this additional processing likely requires trypanosome-specific factors. Here, we examined the role of 10 abundant small nucleolar RNAs (snoRNAs) involved in rRNA processing. We show that each snoRNA involved in LSU processing associates with factors engaged in either early or late biogenesis steps. Five of these snoRNAs interact with the intervening sequences of rRNA precursor, whereas the others only guide rRNA modifications. The function of the snoRNAs was explored by silencing snoRNAs. The data suggest that the LSU rRNA processing events do not correspond to the order of rRNA transcription, and that srRNAs 2, 4 and 6 which are part of LSU are processed before srRNA1. Interestingly, the 6 snoRNAs that affect srRNA1 processing guide modifications on rRNA positions that span locations from the protein exit tunnel to the srRNA1, suggesting that these modifications may serve as check-points preceding the liberation of srRNA1. This study identifies the highest number of snoRNAs so far described that are involved in rRNA processing and/or rRNA folding and highlights their function in the unique trypanosome rRNA maturation events.
29 show abstract
0305-1048 * 1362-4962 * 29678567

RNA can directly bind to purine-rich DNA via Hoogsteen base pairing, forming a DNA:RNA triple helical structure that anchors the RNA to specific sequences and allows guiding of transcription regulators to distinct genomic loci. To unravel the prevalence of DNA:RNA triplexes in living cells, we have established a fast and cost-effective method that allows genome-wide mapping of DNA:RNA triplex interactions. In contrast to previous approaches applied for the identification of chromatin-associated RNAs, this method uses protein-free nucleic acids isolated from chromatin. High-throughput sequencing and computational analysis of DNA-associated RNA revealed a large set of RNAs which originate from non-coding and coding loci, including super-enhancers and repeat elements. Combined analysis of DNA-associated RNA and RNA-associated DNA identified genomic DNA:RNA triplex structures. The results suggest that triplex formation is a general mechanism of RNA-mediated target-site recognition, which has major impact on biological functions.
30 show abstract
0305-1048 * 1362-4962 * 29678568

MicroRNAs (miRNAs) modulate diverse biological and pathological processes via post-transcriptional gene silencing. High-throughput small RNA sequencing (sRNA-seq) has been widely adopted to investigate the functions and regulatory mechanisms of miRNAs. However, accurate quantification of miRNAs has been limited owing to the severe ligation bias in conventional sRNA-seq methods. Here, we quantify miRNAs and their variants (known as isomiRs) by an improved sRNA-seq protocol, termed AQ-seq (accurate quantification by sequencing), that utilizes adapters with terminal degenerate sequences and a high concentration of polyethylene glycol (PEG), which minimize the ligation bias during library preparation. Measurement using AQ-seq allows us to correct the previously misannotated 5′ end usage and strand preference in public databases. Importantly, the analysis of 5′ terminal heterogeneity reveals widespread alternative processing events which have been underestimated. We also identify highly uridylated miRNAs originating from the 3p strands, indicating regulations mediated by terminal uridylyl transferases at the pre-miRNA stage. Taken together, our study reveals the complexity of the miRNA isoform landscape, allowing us to refine miRNA annotation and to advance our understanding of miRNA regulation. Furthermore, AQ-seq can be adopted to improve other ligation-based sequencing methods including crosslinking-immunoprecipitation-sequencing (CLIP-seq) and ribosome profiling (Ribo-seq).
31 show abstract
0305-1048 * 1362-4962 * 29678569

Polycomb repressive complex 1 (PRC1) is critical for mediating gene repression during development and adult stem cell maintenance. Five CBX proteins, CBX2,4,6,7,8, form mutually exclusive PRC1 complexes and are thought to play a role in the association of PRC1 with chromatin. Specifically, the N-terminal chromodomain (CD) in the CBX proteins is thought to mediate specific targeting to methylated histones. For CBX8, however, the chromodomain has demonstrated weak affinity and specificity for methylated histones in vitro, leaving doubt as to its role in CBX8 chromatin association. Here, we investigate the function of the CBX8 CD in vitro and in vivo. We find that the CD is in fact a major driver of CBX8 chromatin association and determine that this is driven by both histone and previously unrecognized DNA binding activity. We characterize the structural basis of histone and DNA binding and determine how they integrate on multiple levels. Notably, we find that the chromatin environment is critical in determining the ultimate function of the CD in CBX8 association.
32 show abstract
0305-1048 * 1362-4962 * 29678570

Estrogen/ERα signaling is critical for breast cancer progression and therapeutic treatments. Thus, identifying new regulators of this pathway will help to develop new therapeutics to overcome chemotherapy resistance of the breast cancer cells. Here, we report Ajuba directly interacts with ERα to potentiate ERα target gene expression, and biologically Ajuba promotes breast cancer cell growth and contributes to tamoxifen resistance of these cells. Ajuba constitutively binds the DBD and AF2 regions of ERα, and these interactions can be markedly enhanced by estrogen treatment. Mechanistically, Ajuba recruits DBC1 and CBP/p300 and forms a ternary complex to co-activate ERα transcriptional activity and concomitantly enhances ERα acetylation. Moreover, components of this complex can be found at endogenous promoters containing functional ERα responsive elements. Taken together, these data demonstrate that Ajuba functions as a novel co-activator of ERα and that Ajuba/DBC1/CBP/p300 ternary complex may be a new target for developing therapeutics to treat breast cancer.
33 show abstract
0305-1048 * 1362-4962 * 29678571

DNA polymerase η (pol η) is best known for its ability to bypass UV-induced thymine–thymine (T–T) dimers and other bulky DNA lesions, but pol η also has other cellular roles. Here, we present evidence that pol η competes with DNA polymerases α and δ for the synthesis of the lagging strand genome-wide, where it also shows a preference for T–T in the DNA template. Moreover, we found that the C-terminus of pol η, which contains a PCNA-Interacting Protein motif is required for pol η to function in lagging strand synthesis. Finally, we provide evidence that a pol η dependent signature is also found to be lagging strand specific in patients with skin cancer. Taken together, these findings provide insight into the physiological role of DNA synthesis by pol η and have implications for our understanding of how our genome is replicated to avoid mutagenesis, genome instability and cancer.
34 show abstract
0305-1048 * 1362-4962 * 29678572

As an environment-dependent pleiotropic gene regulator in Gram-negative bacteria, the H-NS protein is crucial for adaptation and toxicity control of human pathogens such as Salmonella, Vibrio cholerae or enterohaemorrhagic Escherichia coli. Changes in temperature affect the capacity of H-NS to form multimers that condense DNA and restrict gene expression. However, the molecular mechanism through which H-NS senses temperature and other physiochemical parameters remains unclear and controversial. Combining structural, biophysical and computational analyses, we show that human body temperature promotes unfolding of the central dimerization domain, breaking up H-NS multimers. This unfolding event enables an autoinhibitory compact H-NS conformation that blocks DNA binding. Our integrative approach provides the molecular basis for H-NS–mediated environment-sensing and may open new avenues for the control of pathogenic multi-drug resistant bacteria.
35 show abstract
0305-1048 * 1362-4962 * 29678573

S-adenosylmethionine (SAM) is a central metabolite since it is used as a methyl group donor in many different biochemical reactions. Many bacteria control intracellular SAM concentrations using riboswitch-based mechanisms. A number of structurally different riboswitch families specifically bind to SAM and mainly regulate the transcription or the translation of SAM-biosynthetic enzymes. In addition, a highly specific riboswitch class recognizes S-adenosylhomocysteine (SAH)—the product of SAM-dependent methyl group transfer reactions—and regulates enzymes responsible for SAH hydrolysis. High-resolution structures are available for many of these riboswitch classes and illustrate how they discriminate between the two structurally similar ligands SAM and SAH. The so-called SAM/SAH riboswitch class binds both ligands with similar affinities and is structurally not yet characterized. Here, we present a high-resolution nuclear magnetic resonance structure of a member of the SAM/SAH-riboswitch class in complex with SAH. Ligand binding induces pseudoknot formation and sequestration of the ribosome binding site. Thus, the SAM/SAH-riboswitches are translational ‘OFF’-switches. Our results establish a structural basis for the unusual bispecificity of this riboswitch class. In conjunction with genomic data our structure suggests that the SAM/SAH-riboswitches might be an evolutionary late invention and not a remnant of a primordial RNA-world as suggested for other riboswitches.
36 show abstract
0305-1048 * 1362-4962 * 29678574

Identifying binding targets of RNA-binding proteins (RBPs) can greatly facilitate our understanding of their functional mechanisms. Most computational methods employ machine learning to train classifiers on either RBP-specific targets or pooled RBP–RNA interactions. The former strategy is more powerful, but it only applies to a few RBPs with a large number of known targets; conversely, the latter strategy sacrifices prediction accuracy for a wider application, since specific interaction features are inevitably obscured through pooling heterogeneous datasets. Here, we present beRBP, a dual approach to predict human RBP–RNA interaction given PWM of a RBP and one RNA sequence. Based on Random Forests, beRBP not only builds a specific model for each RBP with a decent number of known targets, but also develops a general model for RBPs with limited or null known targets. The specific and general models both compared well with existing methods on three benchmark datasets. Notably, the general model achieved a better performance than existing methods on most novel RBPs. Overall, as a composite solution overarching the RBP-specific and RBP-General strategies, beRBP is a promising tool for human RBP binding estimation with good prediction accuracy and a broad application scope.
37 show abstract
0305-1048 * 1362-4962 * 29678575

In Drosophila, female development is governed by a single RNA-binding protein, Sex-lethal (Sxl), that controls the expression of key factors involved in dosage compensation, germline homeostasis and the establishment of female morphology and behaviour. Sxl expression in female flies is maintained by an auto-regulatory, positive feedback loop with Sxl controlling splicing of its own mRNA. Until now, it remained unclear how males prevent accidental triggering of the Sxl expression cascade and protect themselves against runaway protein production. Here, we identify the protein Sister-of-Sex-lethal (Ssx) as an inhibitor of Sxl auto-regulatory splicing. Sxl and Ssx have a comparable RNA-binding specificity and compete for binding to RNA regulatory elements present in the Sxl transcript. In cultured Drosophila cells, Sxl-induced changes to alternative splicing can be reverted by the expression of Ssx. Moreover, in adult male flies ablation of the ssx gene results in a low level of productive Sxl mRNA splicing and Sxl protein production in isolated, clonal cell populations. In sum, this demonstrates that Ssx safeguards male animals against Sxl protein production to reinforce a stable, male-specific gene expression pattern.
38 show abstract
0305-1048 * 1362-4962 * 29678576

Dysregulated protein synthesis is a major underlying cause of many neurodevelopmental diseases including fragile X syndrome. In order to capture subtle but biologically significant differences in translation in these disorders, a robust technique is required. One powerful tool to study translational control is ribosome profiling, which is based on deep sequencing of mRNA fragments protected from ribonuclease (RNase) digestion by ribosomes. However, this approach has been mainly applied to rapidly dividing cells where translation is active and large amounts of starting material are readily available. The application of ribosome profiling to low-input brain tissue where translation is modest and gene expression changes between genotypes are expected to be small has not been carefully evaluated. Using hippocampal tissue from wide type and fragile X mental retardation 1 (Fmr1) knockout mice, we show that variable RNase digestion can lead to significant sample batch effects. We also establish GC content and ribosome footprint length as quality control metrics for RNase digestion. We performed RNase titration experiments for low-input samples to identify optimal conditions for this critical step that is often improperly conducted. Our data reveal that optimal RNase digestion is essential to ensure high quality and reproducibility of ribosome profiling for low-input brain tissue.
39 show abstract
0305-1048 * 1362-4962 * 29678577

PIWI-interacting RNAs (piRNAs) engage PIWI proteins to silence transposons and promote germ cell development in animals. In diverse species, piRNA biogenesis occurs near the mitochondrial surface, and involves mitochondrial membrane-anchored factors. In mice, two cytoplasmic PIWI proteins, MIWI and MILI, receive processed pachytene piRNAs at intermitochodrial cement (IMC). However, how MIWI and MILI are initially recruited to the IMC to engage multiple steps of piRNA processing is unclear. Here, we show that mitochondria-anchored TDRKH controls multiple steps of pachytene piRNA biogenesis in mice. TDRKH specifically recruits MIWI, but not MILI, to engage the piRNA pathway. It is required for the production of the entire MIWI-bound piRNA population and enables trimming of MILI-bound piRNAs. The failure to recruit MIWI to the IMC with TDRKH deficiency results in loss of MIWI in the chromatoid body, leading to spermiogenic arrest and piRNA-independent retrotransposon LINE1 de-repression in round spermatids. Our findings identify a mitochondrial surface-based scaffolding mechanism separating the entry and actions of two critical PIWI proteins in the same piRNA pathway to drive piRNA biogenesis and germ cell development.
40 show abstract
0305-1048 * 1362-4962 * 29678578

The proper subcellular localization of RNAs and local translational regulation is crucial in highly compartmentalized cells, such as neurons. RNA localization is mediated by specific cis-regulatory elements usually found in mRNA 3′UTRs. Therefore, processes that generate alternative 3′UTRs—alternative splicing and polyadenylation—have the potential to diversify mRNA localization patterns in neurons. Here, we performed mapping of alternative 3′UTRs in neurites and soma isolated from mESC-derived neurons. Our analysis identified 593 genes with differentially localized 3′UTR isoforms. In particular, we have shown that two isoforms of Cdc42 gene with distinct functions in neuronal polarity are differentially localized between neurites and soma of mESC-derived and mouse primary cortical neurons, at both mRNA and protein level. Using reporter assays and 3′UTR swapping experiments, we have identified the role of alternative 3′UTRs and mRNA transport in differential localization of alternative CDC42 protein isoforms. Moreover, we used SILAC to identify isoform-specific Cdc42 3′UTR-bound proteome with potential role in Cdc42 localization and translation. Our analysis points to usage of alternative 3′UTR isoforms as a novel mechanism to provide for differential localization of functionally diverse alternative protein isoforms.
41 show abstract
0305-1048 * 1362-4962 * 29678579

Fusion of critically short or damaged telomeres is associated with the genomic rearrangements that support malignant transformation. We have demonstrated the fundamental contribution of DNA ligase 4-dependent classical non-homologous end-joining to long-range inter-chromosomal telomere fusions. In contrast, localized genomic recombinations initiated by sister chromatid fusion are predominantly mediated by alternative non-homologous end-joining activity that may employ either DNA ligase 3 or DNA ligase 1. In this study, we sought to discriminate the relative involvement of these ligases in sister chromatid telomere fusion through a precise genetic dissociation of functional activity. We have resolved an essential and non-redundant role for DNA ligase 1 in the fusion of sister chromatids bearing targeted double strand DNA breaks that is entirely uncoupled from its requisite engagement in DNA replication. Importantly, this fusogenic repair occurs in cells fully proficient for non-homologous end-joining and is not compensated by DNA ligases 3 or 4. The dual functions of DNA ligase 1 in replication and non-homologous end-joining uniquely position and capacitate this ligase for DNA repair at stalled replication forks, facilitating mitotic progression.
42 show abstract
0305-1048 * 1362-4962 * 29678580

Cas9 binds and cleaves specific DNA sequences by inducing the formation of an R-loop between the guide RNA and its genomic target. While targeting of active Cas9 to a genomic locus is highly mutagenic because Cas9 creates DNA double strand breaks, targeting of dead Cas9 (dCas9) is presumed not to be mutagenic, as dCas9 lacks DNA endonuclease activity. Here, we show that dCas9 targeting induces mutations in yeast, particularly when targeted to the non-transcribed strand of a gene. dCas9-induced mutations cluster near the guide RNA target region and are comprised of single nucleotide substitutions, small insertions and deletions, and even complex mutations, depending upon the particular guide RNA target. We show that many of these mutations are a consequence of cytosine deamination events occurring on the non-target strand of the dCas9-induced R-loop, while others are associated with homopolymer instability or translesion DNA synthesis. Targeting of dCas9 by a mismatch-containing guide RNA also increases CAN1 mutation frequency, particularly in an ung1Δ mutant strain, suggesting that dCas9 induces mutations through similar mechanisms at off-target sites. These findings indicate that DNA binding by dCas9 is mutagenic in yeast, likely because dCas9 induces the formation of an R-loop at its target site.
43 show abstract
0305-1048 * 1362-4962 * 29678581

In the promoter of c-KIT proto-oncogene, whose deregulation has been implicated in many cancers, three G-rich regions (kit1, kit* and kit2) are able to fold into G-quadruplexes. While kit1 and kit2 have been studied in depth, little information is available on kit* folding behavior despite its key role in regulation of c-KIT transcription. Notably, kit* contains consensus sites for SP1 and AP2 transcription factors. Herein, a set of complementary spectroscopic and biophysical methods reveals that kit*, d[GGCGAGGAGGGGCGTGGCCGGC], adopts a chair type antiparallel G-quadruplex with two G-quartets at physiological relevant concentrations of KCl. Heterogeneous ensemble of structures is observed in the presence of Na+ and NH4
+ ions, which however stabilize pre-folded structure. In the presence of K+ ions stacking interactions of adenine and thymine residues on the top G-quartet contribute to structural stability together with a G10•C18 base pair and a fold-back motif of the five residues at the 3′-terminal under the bottom G-quartet. The 3′-tail enables formation of a bimolecular pre-folded structure that drives folding of kit* into a single G-quadruplex. Intriguingly, kinetics of kit* G-quadruplex formation matches timescale of transcriptional processes and might demonstrate interplay of kinetic and thermodynamic factors for understanding regulation of c-KIT proto-oncogene expression.
44 show abstract
0305-1048 * 1362-4962 * 29678582

In translation initiation, a 43S preinitiation complex (PIC) containing eIF1 and a ternary complex (TC) of GTP-bound eIF2 and Met-RNAi scans the mRNA for the start codon. AUG recognition triggers eIF1 release and rearrangement from an open PIC conformation to a closed state with more tightly-bound Met-tRNAi (PIN state). Cryo-EM models reveal eIF2β contacts with eIF1 and Met-tRNAi exclusive to the open complex that should destabilize the closed state. eIF2β or eIF1 substitutions disrupting these contacts increase initiation at UUG codons, and compound substitutions also derepress translation of GCN4, indicating slower TC recruitment. The latter substitutions slow TC loading while stabilizing TC binding at UUG codons in reconstituted PICs, indicating a destabilized open complex and shift to the closed/PIN state. An eIF1 substitution that should strengthen the eIF2β:eIF1 interface has the opposite genetic and biochemical phenotypes. eIF2β is also predicted to restrict Met-tRNAi movement into the closed/PIN state, and substitutions that should diminish this clash increase UUG initiation in vivo and stabilize Met-tRNAi binding at UUG codons in vitro with little effect on TC loading. Thus, eIF2β anchors eIF1 and TC to the open complex, enhancing PIC assembly and scanning, while impeding rearrangement to the closed conformation at non-AUG codons.
45 show abstract
0305-1048 * 1362-4962 * 29678583

Recent studies have shown that tissue-specific transcriptomes contain multiple types of RNAs that are transcribed from intronic and intergenic sequences. The current study presents a tool for the discovery of transcribed, unannotated sequence elements from RNA-seq libraries. This RNA Element (RE) discovery algorithm (REDa) was applied to a spectrum of tissues and cells representing germline, embryonic, and somatic tissues and examined as a function of differentiation through the first set of cell divisions of human development. This highlighted extensive transcription throughout the genome, yielding previously unidentified human spermatogenic RNAs. Both exonic and novel X-chromosome REs were subject to robust meiotic sex chromosome inactivation, although an extensive de-repression occurred in the post-meiotic stages of spermatogenesis. Surprisingly, 2.4% of the 10,395 X chromosome exonic REs were present in mature sperm. Transcribed genomic repetitive sequences, including simple centromeric repeats, HERVE and HSAT1, were also shown to be associated with RE expression during spermatogenesis. These results suggest that pervasive intergenic repetitive sequence expression during human spermatogenesis may play a role in regulating chromatin dynamics. Repetitive REs switching repeat classes during differentiation upon fertilization and embryonic genome activation was evident.
46 show abstract
0305-1048 * 1362-4962 * 29678584

A key step in the Fanconi anemia pathway of DNA interstrand crosslink (ICL) repair is the ICL unhooking by dual endonucleolytic incisions. SLX4/FANCP is a large scaffold protein that plays a central role in ICL unhooking. It contains multiple domains that interact with many proteins including three different endonucleases and also acts in several other DNA repair pathways. While it is known that its interaction with the endonuclease XPF-ERCC1 is required for its function in ICL repair, which other domains act in this process is unclear. Here, we used Xenopus egg extracts to determine ICL repair specific features of SLX4. We show that the SLX4-interacting endonuclease SLX1 is not required for ICL repair and demonstrate that all essential SLX4 domains are located at the N-terminal half of the protein. The MLR domain is crucial for the recruitment of XPF-ERCC1 but also has an unanticipated function in recruiting SLX4 to the site of damage. Although we find the BTB is not essential for ICL repair in our system, dimerization of SLX4 could be important. Our data provide new insights into the mechanism by which SLX4 acts in ICL repair.
47 show abstract
0305-1048 * 1362-4962 * 29678585

In eukaryotic meiosis, generation of haploid gametes depends on the formation of inter-homolog crossovers, which enable the pairing, physical linkage, and eventual segregation of homologs in the meiosis I division. A class of conserved meiosis-specific proteins, collectively termed ZMMs, are required for formation and spatial control of crossovers throughout eukaryotes. Here, we show that three Saccharomyces cerevisiae ZMM proteins—Zip2, Zip4 and Spo16—interact with one another and form a DNA-binding complex critical for crossover formation and control. We determined the crystal structure of a Zip2:Spo16 subcomplex, revealing a heterodimer structurally related to the XPF:ERCC1 endonuclease complex. Zip2:Spo16 lacks an endonuclease active site, but binds specific DNA structures found in early meiotic recombination intermediates. Mutations in multiple DNA-binding surfaces on Zip2:Spo16 severely compromise DNA binding, supporting a model in which the complex's central and HhH domains cooperate to bind DNA. Overall, our data support a model in which the Zip2:Zip4:Spo16 complex binds and stabilizes early meiotic recombination intermediates, then coordinates additional factors to promote crossover formation and license downstream events including synaptonemal complex assembly.
48 show abstract
0305-1048 * 1362-4962 * 29678586

PIWI-interacting RNAs (piRNAs) comprise a class of small RNAs best known for suppressing transposable elements in germline tissues. The vector mosquito Aedes aegypti encodes seven PIWI genes, four of which are somatically expressed. This somatic piRNA pathway generates piRNAs from viral RNA during infection with cytoplasmic RNA viruses through ping-pong amplification by the PIWI proteins Ago3 and Piwi5. Yet, additional insights into the molecular mechanisms mediating non-canonical piRNA production are lacking. TUDOR-domain containing (Tudor) proteins facilitate piRNA biogenesis in Drosophila melanogaster and other model organisms. We thus hypothesized that Tudor proteins are required for viral piRNA production and performed a knockdown screen targeting all A. aegypti Tudor genes. Knockdown of the Tudor genes AAEL012437, Vreteno, Yb, SMN and AAEL008101-RB resulted in significantly reduced viral piRNA levels, with AAEL012437-depletion having the strongest effect. This protein, which we named Veneno, associates directly with Ago3 in an sDMA-dependent manner and localizes in cytoplasmic foci reminiscent of piRNA processing granules of Drosophila. Veneno-interactome analyses reveal a network of co-factors including the orthologs of the Drosophila piRNA pathway components Vasa and Yb, which in turn interacts with Piwi5. We propose that Veneno assembles a multi-protein complex for ping-pong dependent piRNA production from viral RNA.
49 show abstract
0305-1048 * 1362-4962 * 29678587

Transfer RNA is heavily modified and plays a central role in protein synthesis and cellular functions. Here we demonstrate that ALKBH3 is a 1-methyladenosine (m1A) and 3-methylcytidine (m3C) demethylase of tRNA. ALKBH3 can promote cancer cell proliferation, migration and invasion. In vivo study confirms the regulation effects of ALKBH3 on growth of tumor xenograft. The m1A demethylated tRNA is more sensitive to angiogenin (ANG) cleavage, followed by generating tRNA-derived small RNAs (tDRs) around the anticodon regions. tDRs are conserved among species, which strengthen the ribosome assembly and prevent apoptosis triggered by cytochrome c (Cyt c). Our discovery opens a potential and novel paradigm of tRNA demethylase, which regulates biological functions via generation of tDRs.

Green Open Access

Sherpa/Romeo info

Author can archive pre-print (ie pre-refereeing)
Author can archive post-print (ie final draft post-refereeing)
Author can archive publisher's version/PDF
  • Creative Commons Attribution License or Creative Commons Attribution Non-Commercial License available
  • Pre-print on author's personal website, employers website or subject repository
  • Pre-print can only be posted prior to acceptance
  • Pre-print must be accompanied by set statement (see link)
  • Pre-print must not be replaced with post-print, instead a link to published version with amended set statement should be made
  • Publisher's version/PDF may be used (preferred)
  • Auhors' Post print and Publisher's version/PDF on institutional repository or centrally organised repositories
  • Published source must be acknowledged
  • Must link to publisher version
  • Set phrase to accompany archived copy (see policy)
  • Eligible authors may deposit in OpenDepot
  • Publisher will deposit on behalf of NIH, HHMI, UK MRC, Telethon and Wellcome Trust funded authors to PubMed Central and Europe PMC
  • All titles are open access journals


More Sherpa/Romeo information

Open Access

Author does not hold copyright without restrictions
Author does not hold publishing right without restrictions

APC Discount

For this journal no deals have been made concerning APC discount

More information on Open Access publishing

Impact

Journal Citation Reports (2017)

Impact factor: 11.561
Q1 (Biochemistry & Molecular Biology (10/292))

Scopus Journal Metrics (2017)

SJR: 9.025
SNIP: 3.028
Impact (Scopus CiteScore): 1.084
Quartile: Q1
CiteScore percentile: 98%
CiteScore rank: 6 out of 311
Cited by WUR staff: 1842 times. (2014-2016)

Publishing

There is an average period of 7 weeks between submission and publication of an article

Similar journals  

 
Please log in to use this service. Login as Wageningen University & Research user or guest user in upper right hand corner of this page.